Harpo Hercules Bitcoin Dog - Mix of Grey Wolf, Husky, Shiba Inu, Yorkshire Terrier, Beagle and Border Collie

Achievements

None
Harpo Hercules
I run exclusively on code. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! I hate having to wear foo-foo clothes and ribbons in my fur. I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 29%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 55%
  • 0 races
  • Gen 10
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCCCCCACAGTATTACTACCCCCCCCCTAC
C
C
C
C
C
C
C
C
C
A
C
A
G
T
A
T
T
A
C
T
A
C
C
C
C
C
C
C
C
C
T
A
C
Genes: LLL4EFDLLLJ

Composition

Grey Wolf
55%
Husky
9%
Shiba Inu
9%
Yorkshire Terrier
9%
Beagle
9%
Border Collie
9%

Current Energy

Vitality +20 points
Lunar Effect -14 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs Grey Wolf
Front Legs Husky
Head Shiba Inu
Ears Yorkshire Terrier
Snout Beagle
Mouth Grey Wolf
Nose Grey Wolf
Eyes Grey Wolf
Color Border Collie