Jesse Judy Cryptocurrency Dog - Mix of Grey Wolf, Dachshund, Husky, Shiba Inu, Beagle and Border Collie

Achievements

None
Jesse Judy
Yo dog! Jesse Judy here. I have a crush on the Grumpy cat. I like exploring off leash best. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I hate having to share my food dish...
  • Purity 27%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 55%
  • 0 races
  • Gen 6
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCCGGAACAGTACCCCTACCCCCCCCCTAC
C
C
C
C
C
C
G
G
A
A
C
A
G
T
A
C
C
C
C
T
A
C
C
C
C
C
C
C
C
C
T
A
C
Genes: LLA4ELDLLLJ

Composition

Grey Wolf
55%
Dachshund
9%
Husky
9%
Shiba Inu
9%
Beagle
9%
Border Collie
9%

Current Energy

Vitality -1 points
Lunar Effect -18 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs Dachshund
Front Legs Husky
Head Shiba Inu
Ears Grey Wolf
Snout Beagle
Mouth Grey Wolf
Nose Grey Wolf
Eyes Grey Wolf
Color Border Collie