Isadora Interference Cryptocurrency Game Dog - Mix of Grey Wolf, Dachshund, Pitbull terrier, German Shepard, Beagle, Labrador BK and Border Collie

Achievements

None
Isadora Interference
I enjoy staying active, and running circles around puppies and young children. Steak is my absolute favorite, but I prefer to eat chicken for my health. I have a crush on the Grumpy cat. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! Fun-loving and playful only need apply.
  • Purity 18%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 45%
  • 0 races
  • Gen 2
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCCGGATCCTCACCCCTAGCACCCCCCTAC
C
C
C
C
C
C
G
G
A
T
C
C
T
C
A
C
C
C
C
T
A
G
C
A
C
C
C
C
C
C
T
A
C
Genes: LLAN7LD6LLJ

Composition

Grey Wolf
45%
Dachshund
9%
Pitbull terrier
9%
German Shepard
9%
Beagle
9%
Labrador BK
9%
Border Collie
9%

Current Energy

Vitality -9 points
Lunar Effect -12 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs Dachshund
Front Legs Pitbull terrier
Head German Shepard
Ears Grey Wolf
Snout Beagle
Mouth Labrador BK
Nose Grey Wolf
Eyes Grey Wolf
Color Border Collie