Nosey Nikita Bitcoin Dog - Mix of Grey Wolf, German Shepard, Golder Retriever, Pitbull terrier, Dachshund, Labrador BK, St. Bernard and Border Collie

Achievements

None
Nosey Nikita
It's a barkin' beautiful day! Nosey Nikita here. I pee when I'm excited. Creativity is my middle name... I turn everything in to a chew toy. Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I'm just looking for some puppy love.
  • Purity 6%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCAGATCATCCTCACCCGGAGCATGACCCTAC
C
C
C
A
G
A
T
C
A
T
C
C
T
C
A
C
C
C
G
G
A
G
C
A
T
G
A
C
C
C
T
A
C
Genes: L87N7LA6BLJ

Composition

Grey Wolf
27%
German Shepard
18%
Golder Retriever
9%
Pitbull terrier
9%
Dachshund
9%
Labrador BK
9%
St. Bernard
9%
Border Collie
9%

Current Energy

Vitality +7 points
Lunar Effect -12 points

Traits Breakdown

Body Grey Wolf
Tail Golder Retriever
Legs German Shepard
Front Legs Pitbull terrier
Head German Shepard
Ears Grey Wolf
Snout Dachshund
Mouth Labrador BK
Nose St. Bernard
Eyes Grey Wolf
Color Border Collie

Parents

No Children