Atta Agent 47 Litecoin Game Dog - Mix of Grey Wolf, Golder Retriever, German Shepard, Husky, Labrador BK, Maltese, Pug, Yorkshire Terrier, Dachshund and Shiba Inu

Achievements

None
Atta Agent 47
I live inside of a Virtual machine two steps to the right from the firewall. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! What's your favorite bed? Mine is the dirty laundry.
  • Purity 1%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCAGATCACCCACAGCAACCGAATTAGGAGTA
C
C
C
A
G
A
T
C
A
C
C
C
A
C
A
G
C
A
A
C
C
G
A
A
T
T
A
G
G
A
G
T
A
Genes: L87L46K2FAE

Composition

Grey Wolf
18%
Golder Retriever
9%
German Shepard
9%
Husky
9%
Labrador BK
9%
Maltese
9%
Pug
9%
Yorkshire Terrier
9%
Dachshund
9%
Shiba Inu
9%

Current Energy

Vitality +30 points
Lunar Effect -10 points

Traits Breakdown

Body Grey Wolf
Tail Golder Retriever
Legs German Shepard
Front Legs Grey Wolf
Head Husky
Ears Labrador BK
Snout Maltese
Mouth Pug
Nose Yorkshire Terrier
Eyes Dachshund
Color Shiba Inu