Droolius Caesar Deanna Digital Cryptocurrency Dog - Mix of Golder Retriever, Labrador BK, Labrador, German Shepard, Beagle and Border Collie

Achievements

None
Droolius Caesar Deanna
A-yo...Call me Droolius Caesar Deanna. My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I like to respond to sad puppy eyes with sad puppy eyes of my own. I want a mate that knows how to give a proper belly rub!
  • Purity 13%
  • Age 2 months
  • Racing Exp 0
  • Golder Retriever 36%
  • 0 races
  • Gen 3
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAGACCATCACTAGCAAGACCATACAGAAGA
G
C
A
A
G
A
C
C
A
T
C
A
C
T
A
G
C
A
A
G
A
C
C
A
T
A
C
A
G
A
A
G
A
Genes: 6857D685J88

Composition

Golder Retriever
36%
Labrador BK
18%
Labrador
18%
German Shepard
9%
Beagle
9%
Border Collie
9%

Current Energy

Vitality +9 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs Labrador
Front Legs German Shepard
Head Beagle
Ears Labrador BK
Snout Golder Retriever
Mouth Labrador
Nose Border Collie
Eyes Golder Retriever
Color Golder Retriever