Skinny Snuggles Litecoin Dog - Pure German Shepard

Achievements

None
Skinny Snuggles
I'm having some new data architecture built for me, then I'd like to have you over to my place. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. Once I caught a seagull, but it scared me so I let it go. My idea of romance would be to stroll through in the dog park then share a meaty bone with you.
  • Purity 100%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 100%
  • 0 races
  • Gen 23
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality +1 points
Lunar Effect -24 points

Traits Breakdown

Traits 100% Purebred German Shepard