Flo Farley Crypto Dog - Mix of Labrador BK, Grey Wolf, Husky, St. Bernard, Yorkshire Terrier, Corgi and Labrador

Achievements

None
Flo Farley
I live inside of a web app in a big data center. Too much steak gives me the runs! I enjoy mixing it up once in a while by visiting different dog parks. Watching kids play without me is the worst, no? My favorite sport is catching treats my human throws!
  • Purity 9%
  • Age 2 months
  • Racing Exp 0
  • Labrador BK 27%
  • 0 races
  • Gen 12
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGACCCCCCTTAACAGCAAGCGCAACACCAGCA
T
G
A
C
C
C
C
C
C
T
T
A
A
C
A
G
C
A
A
G
C
G
C
A
A
C
A
C
C
A
G
C
A
Genes: BLLF46O6456

Composition

Labrador BK
27%
Grey Wolf
18%
Husky
18%
St. Bernard
9%
Yorkshire Terrier
9%
Corgi
9%
Labrador
9%

Current Energy

Vitality +1 points
Lunar Effect -18 points

Traits Breakdown

Body St. Bernard
Tail Grey Wolf
Legs Grey Wolf
Front Legs Yorkshire Terrier
Head Husky
Ears Labrador BK
Snout Corgi
Mouth Labrador BK
Nose Husky
Eyes Labrador
Color Labrador BK