Toby Tyson Bitcoin Dog - Mix of Labrador, Schnauzer, Corgi, Husky, Pug, Grey Wolf and Pitbull terrier

Achievements

Racer
Toby Tyson
Hey! Call me Toby Tyson. I hate it when I am not the center of attention. I never met a leg I didn't want to hump. My favorite chews are underwear and rawhide...the rawhide lasts longer. I like never worrying about my dog poo. I've got people for that.
  • Purity 11%
  • Age 2 months
  • Racing Exp 34
  • Labrador 27%
  • 6 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 4 0 0
6 races    Best Time15.17 sec
No rank  Racing *** Coins
66.7 % wins (4) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGAACCCCCACCACCAATAAGCTCCAGCATA
A
C
A
G
A
A
C
C
C
C
C
A
C
C
A
C
C
A
A
T
A
A
G
C
T
C
C
A
G
C
A
T
A
Genes: 42L555CONOC

Composition

Labrador
27%
Schnauzer
18%
Corgi
18%
Husky
9%
Pug
9%
Grey Wolf
9%
Pitbull terrier
9%

Current Energy

Vitality +7 points
Lunar Effect -18 points

Traits Breakdown

Body Husky
Tail Pug
Legs Grey Wolf
Front Legs Labrador
Head Labrador
Ears Labrador
Snout Schnauzer
Mouth Corgi
Nose Pitbull terrier
Eyes Corgi
Color Schnauzer