Banjo Blossom Cryptocurrency Game Dog - Mix of Labrador, Border Collie, German Shepard, Beagle, Grey Wolf and Pug

Achievements

Racer
Podium Champion
Banjo Blossom
Nice to meet you! I'm Banjo Blossom. I need laid otherwise I'm going to start agreeing with Grumpy Cat. I hate not being allowed to hunt treasure in the garbage. It smells so good! Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!
  • Purity 12%
  • Age 2 months
  • Racing Exp 23
  • Labrador 27%
  • 5 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 1
5 races    Best Time14.82 sec
No rank  Racing *** Coins
60.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACTACCCTCATACCCATCACCATACTACGAA
C
C
A
C
T
A
C
C
C
T
C
A
T
A
C
C
C
A
T
C
A
C
C
A
T
A
C
T
A
C
G
A
A
Genes: 5DL7J575JJ2

Composition

Labrador
27%
Border Collie
27%
German Shepard
18%
Beagle
9%
Grey Wolf
9%
Pug
9%

Current Energy

Vitality +34 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Beagle
Legs Grey Wolf
Front Legs German Shepard
Head Border Collie
Ears Labrador
Snout German Shepard
Mouth Labrador
Nose Border Collie
Eyes Border Collie
Color Pug