Elsa Ember Litecoin Dog - Mix of Poodle, Grey Wolf, St. Bernard, Husky, Shiba Inu, Golder Retriever and Schnauzer

Achievements

Racer
Elsa Ember
Suh...you good? Elsa Ember here. I'm not a bad dog, my data is just configured that way. I never met a leg I didn't want to hump. I hate hiding under the bed during a thunder storm but that's just smart, right? I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 11%
  • Age 2 months
  • Racing Exp 17
  • Poodle 27%
  • 5 races
  • Gen 10
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 1
5 races    Best Time15.10 sec
No rank  Racing *** Coins
40.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCCTGAACAGACGACGTAAGAGACTGAATA
C
C
C
C
C
C
T
G
A
A
C
A
G
A
C
G
A
C
G
T
A
A
G
A
G
A
C
T
G
A
A
T
A
Genes: LLB4IIE8IBC

Composition

Poodle
27%
Grey Wolf
18%
St. Bernard
18%
Husky
9%
Shiba Inu
9%
Golder Retriever
9%
Schnauzer
9%

Current Energy

Vitality -1 points
Lunar Effect -18 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs St. Bernard
Front Legs Husky
Head Poodle
Ears Poodle
Snout Shiba Inu
Mouth Golder Retriever
Nose Poodle
Eyes St. Bernard
Color Schnauzer