Diesel Dare Crypto Dog - Mix of Poodle, Husky, St. Bernard, Shiba Inu, Grey Wolf and Schnauzer

Achievements

Racer
Diesel Dare
You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I enjoy chasing my tail around. I hate it when my human runs out of poop-bags. How embarrassing! I've always wanted to be in commercials and be treated as the star I am!
  • Purity 12%
  • Age 2 months
  • Racing Exp 8
  • Poodle 27%
  • 3 races
  • Gen 0
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
3 races    Best Time16.93 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACCCTGAACAGACGACGTAGTAGACTGAATA
A
C
A
C
C
C
T
G
A
A
C
A
G
A
C
G
A
C
G
T
A
G
T
A
G
A
C
T
G
A
A
T
A
Genes: 4LB4IIEEIBC

Composition

Poodle
27%
Husky
18%
St. Bernard
18%
Shiba Inu
18%
Grey Wolf
9%
Schnauzer
9%

Current Energy

Vitality -6 points
Lunar Effect -16 points

Traits Breakdown

Body Husky
Tail Grey Wolf
Legs St. Bernard
Front Legs Husky
Head Poodle
Ears Poodle
Snout Shiba Inu
Mouth Shiba Inu
Nose Poodle
Eyes St. Bernard
Color Schnauzer

Parents

Children

Photos

Bitcoin doggy racing