T-Bird Troy Bitcoin Dog - Mix of Labrador BK, Yorkshire Terrier, Labrador, Golder Retriever, Shiba Inu and Beagle

Achievements

Racer
T-Bird Troy
Pleased to meet you! My name's T-Bird Troy. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I never knew my father. I like exploring off leash best. My human's feet are definitely the greatest smell ever. Especially after a long day at work!
  • Purity 11%
  • Age 2 months
  • Racing Exp 14
  • Labrador BK 27%
  • 2 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 1
2 races    Best Time15.92 sec
No rank  Racing *** Coins
100.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGCACTATTACCAGCAAGAAGAGCATTACCA
G
T
A
G
C
A
C
T
A
T
T
A
C
C
A
G
C
A
A
G
A
A
G
A
G
C
A
T
T
A
C
C
A
Genes: E6DF56886F5

Composition

Labrador BK
27%
Yorkshire Terrier
18%
Labrador
18%
Golder Retriever
18%
Shiba Inu
9%
Beagle
9%

Current Energy

Vitality -20 points
Lunar Effect -10 points

Traits Breakdown

Body Shiba Inu
Tail Labrador BK
Legs Beagle
Front Legs Yorkshire Terrier
Head Labrador
Ears Labrador BK
Snout Golder Retriever
Mouth Golder Retriever
Nose Labrador BK
Eyes Yorkshire Terrier
Color Labrador