Big League Basil Bitcoin Game Dog - Pure German Shepard

Achievements

Racer
Big League Basil
Even living on the internet like I do, too much kibble makes my bandwidth expand. I like exploring off leash best. I live life by my favorite quote "Every dog has it's day", but every day is my day! I hate having to wear foo-foo clothes and ribbons in my fur.
  • Purity 100%
  • Age 3 months
  • Racing Exp 23
  • German Shepard 100%
  • 7 races
  • Gen 21
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 2
7 races    Best Time16.17 sec
Rank 69  Racing *** Coins
42.9 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard