Newton Nemo Crypto Dog - Pure German Shepard

Achievements

Racer
Newton Nemo
What's up, pup? Name's Newton Nemo. I live behind a firewall in the Machine. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! Shy dogs that tuck tail bore me. I like to respond to sad puppy eyes with sad puppy eyes of my own.
  • Purity 100%
  • Age 2 months
  • Racing Exp 19
  • German Shepard 100%
  • 7 races
  • Gen 17
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 2 0
7 races    Best Time15.30 sec
No rank  Racing *** Coins
28.6 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality +1 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard