Eeyore Elmer Litecoin Game Dog - Pure German Shepard

Achievements

Racer
Eeyore Elmer
Hey there! Baby, call me Eeyore Elmer. Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks...
  • Purity 100%
  • Age 2 months
  • Racing Exp 28
  • German Shepard 100%
  • 7 races
  • Gen 12
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 3 0 0
7 races    Best Time14.55 sec
Rank 61  Racing *** Coins
42.9 % wins (3) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -2 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard