Alfie Allie Digital Cryptocurrency Game Dog - Pure German Shepard

Achievements

Racer
Podium Champion
Alfie Allie
Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite!
  • Purity 100%
  • Age 2 months
  • Racing Exp 45
  • German Shepard 100%
  • 8 races
  • Gen 20
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 3 1 2
8 races    Best Time15.72 sec
No rank  Racing *** Coins
75.0 % wins (6) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -5 points
Lunar Effect -24 points

Traits Breakdown

Traits 100% Purebred German Shepard