Endzone Elf Bitcoin Game Dog - Mix of Schnauzer, Golder Retriever, Dachshund and German Shepard

Achievements

Racer
Endzone Elf
Who's a good dog? Hopefully you! Endzone Elf here. I live in cyberspace where you can turn me on. When my human brushes my coat, I get frisky! What's your favorite bed? Mine is the dirty laundry. I'm looking for someone smart enough to help me find the treat stash.
  • Purity 52%
  • Age 14 months
  • Racing Exp 16
  • Schnauzer 73%
  • 4 races
  • Gen 12
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 0 2 0
 Best Time16.70 sec
Rank 82  Racing *** Coins
50.0 % wins (2) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: ATAATAATAATAATAAGAATAATAGGATCAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
G
A
A
T
A
A
T
A
G
G
A
T
C
A
A
T
A
Genes: CCCCC8CCA7C

Composition

Schnauzer
73%
Golder Retriever
9%
Dachshund
9%
German Shepard
9%

Current Energy

Vitality -61 points
Lunar Effect -14 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Golder Retriever
Snout Schnauzer
Mouth Schnauzer
Nose Dachshund
Eyes German Shepard
Color Schnauzer