Endzone Elf Bitcoin Game Dog - Mix of Schnauzer, Golder Retriever, Dachshund and German Shepard

Achievements

None
Endzone Elf
Who's a good dog? Hopefully you! Endzone Elf here. I live in cyberspace where you can turn me on. When my human brushes my coat, I get frisky! What's your favorite bed? Mine is the dirty laundry. I'm looking for someone smart enough to help me find the treat stash.
  • Purity 52%
  • Age 10 days
  • Racing Exp 0
  • Schnauzer 73%
  • 0 races
  • Gen 12
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: ATAATAATAATAATAAGAATAATAGGATCAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
G
A
A
T
A
A
T
A
G
G
A
T
C
A
A
T
A
Genes: CCCCC8CCA7C

Composition

Schnauzer
73%
Golder Retriever
9%
Dachshund
9%
German Shepard
9%

Current Energy

Vitality -1 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Golder Retriever
Snout Schnauzer
Mouth Schnauzer
Nose Dachshund
Eyes German Shepard
Color Schnauzer

Parents

No Children