Rolls Royce Ralphie Bitcoin Game Dog - Mix of German Shepard, Labrador, Corgi, Husky, Pug, Beagle, Golder Retriever, Labrador BK and Yorkshire Terrier

Achievements

None
Rolls Royce Ralphie
Whatcha know, honey. Rolls Royce Ralphie here. If you have fleas or ticks, don't bother. I really enjoy heavy petting. My favorite place in the world is the dog park. So many smells! I never knew my father.
  • Purity 3%
  • Age 11 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAAGCTCAACACCAGAACCACTAAGAGCATTA
T
C
A
A
G
C
T
C
A
A
C
A
C
C
A
G
A
A
C
C
A
C
T
A
A
G
A
G
C
A
T
T
A
Genes: 7O74525D86F

Composition

German Shepard
18%
Labrador
18%
Corgi
9%
Husky
9%
Pug
9%
Beagle
9%
Golder Retriever
9%
Labrador BK
9%
Yorkshire Terrier
9%

Current Energy

Vitality +45 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs German Shepard
Front Legs Husky
Head Labrador
Ears Pug
Snout Labrador
Mouth Beagle
Nose Golder Retriever
Eyes Labrador BK
Color Yorkshire Terrier

Parents

No Children