Linx Luke Crypto Game Dog - Mix of Shiba Inu, Grey Wolf, Border Collie and Boxer

Achievements

None
Linx Luke
I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? My favorite place to sleep is under the covers between my humans. My 'G' spot is under my chin...scratch me there and I'll growl softly.
  • Purity 41%
  • Age 10 days
  • Racing Exp 0
  • Shiba Inu 64%
  • 0 races
  • Gen 14
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACAACGTACCCGTAGTAGTAGTAGTAGTACCC
T
A
C
A
A
C
G
T
A
C
C
C
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
C
C
C
Genes: JGELEEEEEEL

Composition

Shiba Inu
64%
Grey Wolf
18%
Border Collie
9%
Boxer
9%

Current Energy

Vitality +48 points
Lunar Effect +22 points

Traits Breakdown

Body Border Collie
Tail Boxer
Legs Shiba Inu
Front Legs Grey Wolf
Head Shiba Inu
Ears Shiba Inu
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Grey Wolf