Bridgett Babe Bitcoin Game Dog - Mix of Schnauzer and German Shepard

Achievements

None
Bridgett Babe
I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I need laid otherwise I'm going to start agreeing with Grumpy Cat. My favorite sport is catching treats my human throws! Fun-loving and playful only need apply.
  • Purity 82%
  • Age 11 days
  • Racing Exp 0
  • Schnauzer 91%
  • 0 races
  • Gen 11
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATAATAATAATAATAATAATAATAATATCAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
T
C
A
A
T
A
Genes: CCCCCCCCC7C

Composition

Schnauzer
91%
German Shepard
9%

Current Energy

Vitality -7 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Schnauzer
Snout Schnauzer
Mouth Schnauzer
Nose Schnauzer
Eyes German Shepard
Color Schnauzer