Sulu Shelly Crypto Dog - Mix of St. Bernard, German Shepard, Grey Wolf, Border Collie and Shiba Inu

Achievements

Racer
Sulu Shelly
It's a barkin' beautiful day! Sulu Shelly here. I run with a pack in the data warehouse. I hate it when humans put the lid down. My favorite thing is to sit in my humans' laps while they are trying to read or drive. I'm a serial monogamist. I like exploring off leash best.
  • Purity 36%
  • Age 14 days
  • Racing Exp 8
  • St. Bernard 64%
  • 3 races
  • Gen 10
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 0 1
 Best Time16.10 sec
No rank  Racing *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCATGATGACCCTGATACTGAGTATGATGATGA
T
C
A
T
G
A
T
G
A
C
C
C
T
G
A
T
A
C
T
G
A
G
T
A
T
G
A
T
G
A
T
G
A
Genes: 7BBLBJBEBBB

Composition

St. Bernard
64%
German Shepard
9%
Grey Wolf
9%
Border Collie
9%
Shiba Inu
9%

Current Energy

Vitality +47 points
Lunar Effect +12 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs St. Bernard
Front Legs Grey Wolf
Head St. Bernard
Ears Border Collie
Snout St. Bernard
Mouth Shiba Inu
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard