Mercedes Mojo Litecoin Game Dog - Mix of Grey Wolf, Border Collie, Corgi, Golder Retriever and Pug

Achievements

Racer
Mercedes Mojo
Hello, I'm Mercedes Mojo. How's it goin'? I never knew my father. Don't bother contacting me if you like cats. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!
  • Purity 29%
  • Age 12 days
  • Racing Exp 8
  • Grey Wolf 55%
  • 1 races
  • Gen 9
Share it to make him Happy!
Neutral & Tardy
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 1 0 0
 Best Time16.58 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: TACAGCCCCCCCTACAGACCCGAACCCCCCCCC
T
A
C
A
G
C
C
C
C
C
C
C
T
A
C
A
G
A
C
C
C
G
A
A
C
C
C
C
C
C
C
C
C
Genes: JOLLJ8L2LLL

Composition

Grey Wolf
55%
Border Collie
18%
Corgi
9%
Golder Retriever
9%
Pug
9%

Current Energy

Vitality +56 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Grey Wolf
Front Legs Grey Wolf
Head Border Collie
Ears Golder Retriever
Snout Grey Wolf
Mouth Pug
Nose Grey Wolf
Eyes Grey Wolf
Color Grey Wolf

Parents

No Children

Photos

Bitcoin doggy racing