Ibuki Ibby Crypto Dog - Mix of Golder Retriever and Husky

Achievements

Racer
Ibuki Ibby
Top o' the mornin' to ya! I'm Ibuki Ibby. I'll outrun you for the ball if I can...that's just how I roll. I really dislike stinky flea collars. I enjoy exploration and am game for anything doggy-style. I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 61%
  • Age 13 days
  • Racing Exp 14
  • Golder Retriever 73%
  • 3 races
  • Gen 12
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 1 1
 Best Time17.05 sec
No rank  Racing *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAAGAAGAAGAAGAAGAAGAAGAAGAACAACA
A
C
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
C
A
A
C
A
Genes: 48888888844

Composition

Golder Retriever
73%
Husky
27%

Current Energy

Vitality +41 points
Lunar Effect -18 points

Traits Breakdown

Body Husky
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Golder Retriever
Eyes Husky
Color Husky