Goofy Goliath Bitcoin Game Dog - Mix of Shiba Inu, Labrador, Boxer, German Shepard and St. Bernard

Achievements

Racer
Goofy Goliath
I love cuddling up, doggy-style after a romantic evening. I'm willing to try little bondage, so my human chained me up! I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I hate hiding under the bed during a thunder storm but that's just smart, right?
  • Purity 40%
  • Age 12 days
  • Racing Exp 9
  • Shiba Inu 64%
  • 2 races
  • Gen 8
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 0
 Best Time16.42 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: CCAAACGTATCAGTAGTAGTAGTAGTAGTATGA
C
C
A
A
A
C
G
T
A
T
C
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
T
G
A
Genes: 5GE7EEEEEEB

Composition

Shiba Inu
64%
Labrador
9%
Boxer
9%
German Shepard
9%
St. Bernard
9%

Current Energy

Vitality +52 points
Lunar Effect +16 points

Traits Breakdown

Body Labrador
Tail Boxer
Legs Shiba Inu
Front Legs German Shepard
Head Shiba Inu
Ears Shiba Inu
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color St. Bernard