Jenna Jett Cryptocurrency Dog - Mix of Schnauzer, Labrador and German Shepard

Achievements

Racer
Jenna Jett
Greetings. My name is Jenna Jett. My AI may be artificial, but at least I'm intelligent. I absolutely love long walks when I can stop and smell the bushes. I've always had a crush on Lassie. I'm looking for someone who is also playful, feisty and happy.
  • Purity 67%
  • Age 12 days
  • Racing Exp 8
  • Schnauzer 82%
  • 2 races
  • Gen 10
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 1 0
 Best Time16.73 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: ATAATAATAATAATAATAATAATACCATCAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
C
C
A
T
C
A
A
T
A
Genes: CCCCCCCC57C

Composition

Schnauzer
82%
Labrador
9%
German Shepard
9%

Current Energy

Vitality -1 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Schnauzer
Snout Schnauzer
Mouth Schnauzer
Nose Labrador
Eyes German Shepard
Color Schnauzer