Red Shirt Ryu Digital Cryptocurrency Dog - Mix of German Shepard, Husky, Golder Retriever, Pitbull terrier, Border Collie, Shiba Inu and St. Bernard

Achievements

Racer
Red Shirt Ryu
Howdy there. I'm Red Shirt Ryu. I'm an avid runner! Outside, inside, all over the place! I just want to run! Too much steak gives me the runs! Aggressive dogs that don't let 'me be me' frustrate me. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos.
  • Purity 16%
  • Age 13 days
  • Racing Exp 8
  • German Shepard 45%
  • 3 races
  • Gen 13
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 0 1
 Best Time16.62 sec
No rank  Racing *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAACAAGATCATCATCCTACTCAGTATCATGA
T
C
A
A
C
A
A
G
A
T
C
A
T
C
A
T
C
C
T
A
C
T
C
A
G
T
A
T
C
A
T
G
A
Genes: 74877NJ7E7B

Composition

German Shepard
45%
Husky
9%
Golder Retriever
9%
Pitbull terrier
9%
Border Collie
9%
Shiba Inu
9%
St. Bernard
9%

Current Energy

Vitality +50 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Husky
Legs Golder Retriever
Front Legs German Shepard
Head German Shepard
Ears Pitbull terrier
Snout Border Collie
Mouth German Shepard
Nose Shiba Inu
Eyes German Shepard
Color St. Bernard