Khloe Koko Litecoin Dog - Mix of Husky and German Shepard

Achievements

Racer
Khloe Koko
If you'd like to get together, I'm Khloe Koko. I'd like to take you for a byte to eat in cyberspace. I hate being left alone all day. I don't understand why I like smelling butts... My idea of romance would be to stroll through in the dog park then share a meaty bone with you.
  • Purity 70%
  • Age 13 days
  • Racing Exp 31
  • Husky 82%
  • 4 races
  • Gen 15
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 3 1 0
 Best Time14.67 sec
No rank  Racing *** Pts
100.0 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAACAACATCATCAACAACAACAACAACAACA
A
C
A
A
C
A
A
C
A
T
C
A
T
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 44477444444

Composition

Husky
82%
German Shepard
18%

Current Energy

Vitality +66 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs German Shepard
Head German Shepard
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky