Cordelia Chica Digital Cryptocurrency Dog - Mix of German Shepard, Border Collie, Husky, Pitbull terrier, Shiba Inu, Labrador and St. Bernard

Achievements

Racer
Cordelia Chica
Yo dog! Cordelia Chica here. Someday I'm gonna breakout from inside this server. If I can't reach it to clean it myself, it doesn't need cleaning! I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 10%
  • Age 13 days
  • Racing Exp 16
  • German Shepard 36%
  • 3 races
  • Gen 5
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 1 0
 Best Time16.25 sec
No rank  Racing *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAACATCATACTCATCCTACGTACCATCATGA
T
C
A
A
C
A
T
C
A
T
A
C
T
C
A
T
C
C
T
A
C
G
T
A
C
C
A
T
C
A
T
G
A
Genes: 747J7NJE57B

Composition

German Shepard
36%
Border Collie
18%
Husky
9%
Pitbull terrier
9%
Shiba Inu
9%
Labrador
9%
St. Bernard
9%

Current Energy

Vitality +54 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Husky
Legs German Shepard
Front Legs Border Collie
Head German Shepard
Ears Pitbull terrier
Snout Border Collie
Mouth Shiba Inu
Nose Labrador
Eyes German Shepard
Color St. Bernard