Brunhilda Blanche Litecoin Game Dog - Mix of Husky, Beagle, German Shepard, Labrador, Grey Wolf, Dachshund, Golder Retriever and Maltese

Achievements

Racer
TOP 10 Fastest
Brunhilda Blanche
Whatcha know, honey. Brunhilda Blanche here. I love it when you show a little teeth. Aggressive dogs that don't let 'me be me' frustrate me. I'm the best at running circle 8's. My favorite sport is catching treats my human throws!
  • Purity 6%
  • Age 12 days
  • Racing Exp 14
  • Husky 27%
  • 2 races
  • Gen 4
Share it to make him Happy!
Neutral & Tardy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 1
 Best Time14.25 sec
Rank 3  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: TCACTAACACCACCCGGAACAAGAACCCTAACA
T
C
A
C
T
A
A
C
A
C
C
A
C
C
C
G
G
A
A
C
A
A
G
A
A
C
C
C
T
A
A
C
A
Genes: 7D45LA48KD4

Composition

Husky
27%
Beagle
18%
German Shepard
9%
Labrador
9%
Grey Wolf
9%
Dachshund
9%
Golder Retriever
9%
Maltese
9%

Current Energy

Vitality +54 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Husky
Front Legs Labrador
Head Grey Wolf
Ears Dachshund
Snout Husky
Mouth Golder Retriever
Nose Maltese
Eyes Beagle
Color Husky

Parents

No Children

Photos

cryptocurrency dog race podium virtual pet race