Brunhilda Blanche Litecoin Game Dog - Mix of Husky, Beagle, German Shepard, Labrador, Grey Wolf, Dachshund, Golder Retriever and Maltese

Achievements

Racer
Podium Champion
Brunhilda Blanche
Whatcha know, honey. Brunhilda Blanche here. I love it when you show a little teeth. Aggressive dogs that don't let 'me be me' frustrate me. I'm the best at running circle 8's. My favorite sport is catching treats my human throws!
  • Purity 6%
  • Age 14 months
  • Racing Exp 22
  • Husky 27%
  • 4 races
  • Gen 4
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 1 1 1
 Best Time14.25 sec
No rank  Racing *** Coins
75.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACTAACACCACCCGGAACAAGAACCCTAACA
T
C
A
C
T
A
A
C
A
C
C
A
C
C
C
G
G
A
A
C
A
A
G
A
A
C
C
C
T
A
A
C
A
Genes: 7D45LA48KD4

Composition

Husky
27%
Beagle
18%
German Shepard
9%
Labrador
9%
Grey Wolf
9%
Dachshund
9%
Golder Retriever
9%
Maltese
9%

Current Energy

Vitality -6 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Husky
Front Legs Labrador
Head Grey Wolf
Ears Dachshund
Snout Husky
Mouth Golder Retriever
Nose Maltese
Eyes Beagle
Color Husky