Verona Vava Digital Cryptocurrency Dog - Mix of Rottweiler, Beagle, Grey Wolf, Labrador, Schnauzer and Maltese

Achievements

Racer
Verona Vava
Hey, good-looking! This is Verona Vava. You know the worst? Watching my humans 'get it on' and I have to lick myself. Size doesn't matter, I like 'em all. When my human brushes my coat, I get frisky! My favorite thing is to sit in my humans' laps while they are trying to read or drive.
  • Purity 14%
  • Age 13 days
  • Racing Exp 2
  • Rottweiler 27%
  • 2 races
  • Gen 3
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time16.62 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCACACCACATACTACCCCCCCTACACCTAACC
C
C
A
C
A
C
C
A
C
A
T
A
C
T
A
C
C
C
C
C
C
C
T
A
C
A
C
C
T
A
A
C
C
Genes: 5HHCDLLDHDK

Composition

Rottweiler
27%
Beagle
27%
Grey Wolf
18%
Labrador
9%
Schnauzer
9%
Maltese
9%

Current Energy

Vitality +16 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador
Tail Rottweiler
Legs Rottweiler
Front Legs Schnauzer
Head Beagle
Ears Grey Wolf
Snout Grey Wolf
Mouth Beagle
Nose Rottweiler
Eyes Beagle
Color Maltese

Parents

No Children

Photos