Abbie Avery Litecoin Dog - Mix of Border Collie, Maltese, Pitbull terrier, St. Bernard, Dachshund, Husky and Labrador BK

Achievements

Racer
Abbie Avery
What's up? I'm Abbie Avery. Have you ever dated a digital creation before? I'm a serial monogamist. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I love fetching anything my human throws! Ever play 'catch' with two humans then it turns into 'keep away'? Hate that.
  • Purity 12%
  • Age 13 days
  • Racing Exp 9
  • Border Collie 27%
  • 2 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 0
 Best Time14.73 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACACCTACTCCTGAGGAACAGCAACCACCTAC
T
A
C
A
C
C
T
A
C
T
C
C
T
G
A
G
G
A
A
C
A
G
C
A
A
C
C
A
C
C
T
A
C
Genes: JKJNBA46KKJ

Composition

Border Collie
27%
Maltese
27%
Pitbull terrier
9%
St. Bernard
9%
Dachshund
9%
Husky
9%
Labrador BK
9%

Current Energy

Vitality +41 points
Lunar Effect +8 points

Traits Breakdown

Body Border Collie
Tail Maltese
Legs Border Collie
Front Legs Pitbull terrier
Head St. Bernard
Ears Dachshund
Snout Husky
Mouth Labrador BK
Nose Maltese
Eyes Maltese
Color Border Collie

Parents

No Children

Photos

Bitcoin doggy racing