Bimmer Big League Digital Cryptocurrency Game Dog - Mix of Rottweiler, Grey Wolf, Beagle and Maltese

Achievements

Racer
Bimmer Big League
As a good digital dog, my humans give me virtually everything. I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. Rolling around on the carpet after a bath is my favorite way to dry. I'm looking to share time together and not just to be an accessory.
  • Purity 41%
  • Age 13 days
  • Racing Exp 15
  • Rottweiler 64%
  • 2 races
  • Gen 10
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 1 0
 Best Time16.82 sec
No rank  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACCACCACCACCACCACCCCCTACACCCCACC
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
C
C
C
T
A
C
A
C
C
C
C
A
C
C
Genes: HHHHHHLDHLK

Composition

Rottweiler
64%
Grey Wolf
18%
Beagle
9%
Maltese
9%

Current Energy

Vitality +32 points
Lunar Effect -2 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Rottweiler
Front Legs Rottweiler
Head Rottweiler
Ears Rottweiler
Snout Grey Wolf
Mouth Beagle
Nose Rottweiler
Eyes Grey Wolf
Color Maltese