Han Solo Han Solo Litecoin Dog - Mix of St. Bernard and Grey Wolf

Achievements

Racer
Han Solo Han Solo
Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).
  • Purity 70%
  • Age 12 days
  • Racing Exp 7
  • St. Bernard 82%
  • 2 races
  • Gen 11
Share it to make him Happy!
Neutral & Tardy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 1
 Best Time17.82 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCCCCTGATGATGATGATGATGATGATGATGA
C
C
C
C
C
C
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
Genes: LLBBBBBBBBB

Composition

St. Bernard
82%
Grey Wolf
18%

Current Energy

Vitality +46 points
Lunar Effect +6 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs St. Bernard
Front Legs St. Bernard
Head St. Bernard
Ears St. Bernard
Snout St. Bernard
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard

Parents

No Children

Photos

crypto pet racing