Sable Scottie Bitcoin Game Dog - Mix of Border Collie, St. Bernard, Pitbull terrier, Dachshund, Labrador BK, German Shepard, Husky and Pug

Achievements

Racer
Sable Scottie
Nice to meet you! I'm Sable Scottie. Nyan Cat is my best friend here in the cyberspace. I have a crush on the Grumpy cat. Halloween costumes are the worst, I hate 'em! After introductory sniffing, I like some licking. Getting out of a long relationship, not looking for another
  • Purity 4%
  • Age 12 days
  • Racing Exp 16
  • Border Collie 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 2 0 0
 Best Time16.40 sec
No rank  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTGATACTCCTGAGGATCCGCATCAACAGAA
T
A
C
T
G
A
T
A
C
T
C
C
T
G
A
G
G
A
T
C
C
G
C
A
T
C
A
A
C
A
G
A
A
Genes: JBJNBAN6742

Composition

Border Collie
18%
St. Bernard
18%
Pitbull terrier
18%
Dachshund
9%
Labrador BK
9%
German Shepard
9%
Husky
9%
Pug
9%

Current Energy

Vitality +46 points
Lunar Effect +2 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs Border Collie
Front Legs Pitbull terrier
Head St. Bernard
Ears Dachshund
Snout Pitbull terrier
Mouth Labrador BK
Nose German Shepard
Eyes Husky
Color Pug