Nola Nessie Crypto Dog - Mix of Beagle, Dachshund, Labrador, Grey Wolf, Poodle, Corgi, Yorkshire Terrier, St. Bernard and Schnauzer

Achievements

Racer
Nola Nessie
Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 5%
  • Age 13 days
  • Racing Exp 14
  • Beagle 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 2 0
 Best Time15.33 sec
Rank 40  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCACCCGACAGCCTATTATGAGGAGGACTAATA
C
C
A
C
C
C
G
A
C
A
G
C
C
T
A
T
T
A
T
G
A
G
G
A
G
G
A
C
T
A
A
T
A
Genes: 5LIODFBAADC

Composition

Beagle
18%
Dachshund
18%
Labrador
9%
Grey Wolf
9%
Poodle
9%
Corgi
9%
Yorkshire Terrier
9%
St. Bernard
9%
Schnauzer
9%

Current Energy

Vitality +22 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador
Tail Grey Wolf
Legs Poodle
Front Legs Corgi
Head Beagle
Ears Yorkshire Terrier
Snout St. Bernard
Mouth Dachshund
Nose Dachshund
Eyes Beagle
Color Schnauzer

Parents

Children

Photos

crypto dog racing virtual dog race