Chi Chi Cheyenne Digital Cryptocurrency Dog - Mix of Beagle, Labrador, German Shepard, Pug, Dachshund, Shiba Inu, Golder Retriever, Maltese and Labrador BK

Achievements

Racer
TOP 10 Fastest
Chi Chi Cheyenne
They call me Chi Chi Cheyenne. What's your name? The Ethernet where I live, rocks. I have a crush on the Grumpy cat. I love unconditionally. Eat, sleep, poop. Honey, I've got it made. I hate going to the vet and will do almost anything to avoid it. I 'm here for something RUFF ;)
  • Purity 5%
  • Age 13 days
  • Racing Exp 14
  • Beagle 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 1
 Best Time14.62 sec
Rank 8  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCACTACCACCAGAAGGAGTAAGAACCCTAGCA
T
C
A
C
T
A
C
C
A
C
C
A
G
A
A
G
G
A
G
T
A
A
G
A
A
C
C
C
T
A
G
C
A
Genes: 7D552AE8KD6

Composition

Beagle
18%
Labrador
18%
German Shepard
9%
Pug
9%
Dachshund
9%
Shiba Inu
9%
Golder Retriever
9%
Maltese
9%
Labrador BK
9%

Current Energy

Vitality +51 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Labrador
Front Legs Labrador
Head Pug
Ears Dachshund
Snout Shiba Inu
Mouth Golder Retriever
Nose Maltese
Eyes Beagle
Color Labrador BK