Astaroth Accord Virtual Crypto Game Dog - Mix of German Shepard, Husky, Border Collie, Golder Retriever, Pitbull terrier, Grey Wolf, Shiba Inu and Poodle

Achievements

Racer
Astaroth Accord
Baby, I'm made from the same stuff as dreams. When my human brushes my coat, I get frisky! Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. When I can break free, I enjoy exploring my neighborhood without my human. You scratch my belly and I'll scratch yours ;)
  • Purity 4%
  • Age 13 days
  • Racing Exp 9
  • German Shepard 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 0
 Best Time16.75 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAACAAGATACTCATCCTACCCCGTAGACACA
T
C
A
A
C
A
A
G
A
T
A
C
T
C
A
T
C
C
T
A
C
C
C
C
G
T
A
G
A
C
A
C
A
Genes: 748J7NJLEI4

Composition

German Shepard
18%
Husky
18%
Border Collie
18%
Golder Retriever
9%
Pitbull terrier
9%
Grey Wolf
9%
Shiba Inu
9%
Poodle
9%

Current Energy

Vitality +54 points
Lunar Effect -12 points

Traits Breakdown

Body German Shepard
Tail Husky
Legs Golder Retriever
Front Legs Border Collie
Head German Shepard
Ears Pitbull terrier
Snout Border Collie
Mouth Grey Wolf
Nose Shiba Inu
Eyes Poodle
Color Husky