Jamie Jade Cryptocurrency Dog - Mix of Dachshund, Corgi, German Shepard, Husky, Rottweiler, Pug, Pitbull terrier, Beagle and Boxer

Achievements

Racer
Jamie Jade
Top o' the mornin' to ya! I'm Jamie Jade. Shy dogs that tuck tail bore me. I have a crush on the Grumpy cat. Air Bud is definitely my favorite movie. What a role model! I really enjoy heavy petting.
  • Purity 3%
  • Age 13 days
  • Racing Exp 9
  • Dachshund 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 0
 Best Time17.13 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAAGCTCAACACACGAATCCCTAAGCGGAAAC
G
G
A
A
G
C
T
C
A
A
C
A
C
A
C
G
A
A
T
C
C
C
T
A
A
G
C
G
G
A
A
A
C
Genes: AO74H2NDOAG

Composition

Dachshund
18%
Corgi
18%
German Shepard
9%
Husky
9%
Rottweiler
9%
Pug
9%
Pitbull terrier
9%
Beagle
9%
Boxer
9%

Current Energy

Vitality +40 points
Lunar Effect -6 points

Traits Breakdown

Body Dachshund
Tail Corgi
Legs German Shepard
Front Legs Husky
Head Rottweiler
Ears Pug
Snout Pitbull terrier
Mouth Beagle
Nose Corgi
Eyes Dachshund
Color Boxer