Jerry Lee Johnny Cage Litecoin Dog - Mix of Labrador, Beagle, Maltese, Rottweiler, German Shepard, Husky, Schnauzer and Pug

Achievements

Racer
Jerry Lee Johnny Cage
Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I enjoy mixing it up once in a while by visiting different dog parks. Watching kids play without me is the worst, no? I cry whenever I hear an ambulance siren!
  • Purity 4%
  • Age 12 days
  • Racing Exp 14
  • Labrador 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 1
 Best Time15.42 sec
Rank 46  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCACACCTACCATCAACCACAATACTAGAAACC
C
C
A
C
A
C
C
T
A
C
C
A
T
C
A
A
C
C
A
C
A
A
T
A
C
T
A
G
A
A
A
C
C
Genes: 5HD57K4CD2K

Composition

Labrador
18%
Beagle
18%
Maltese
18%
Rottweiler
9%
German Shepard
9%
Husky
9%
Schnauzer
9%
Pug
9%

Current Energy

Vitality +41 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Rottweiler
Legs Beagle
Front Legs Labrador
Head German Shepard
Ears Maltese
Snout Husky
Mouth Schnauzer
Nose Beagle
Eyes Pug
Color Maltese

Parents

No Children

Photos

online canine race photo online pet race results