Barnaby Bilbo Litecoin Dog - Mix of Golder Retriever, French Bulldog, Pug, Labrador, Schnauzer, Grey Wolf, German Shepard and Dachshund

Achievements

Racer
Barnaby Bilbo
Howdy potential partner! Barnaby Bilbo here. I hate it when humans put the lid down. I like never worrying about my dog poo. I've got people for that. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! My humans say I slobber too much, but hey, I'm just juicy.
  • Purity 6%
  • Age 13 days
  • Racing Exp 9
  • Golder Retriever 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 0
 Best Time16.40 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAATACCCAGATCAGGACGAGAAGAACGAAGA
C
C
A
A
T
A
C
C
C
A
G
A
T
C
A
G
G
A
C
G
A
G
A
A
G
A
A
C
G
A
A
G
A
Genes: 5CL87A92298

Composition

Golder Retriever
18%
French Bulldog
18%
Pug
18%
Labrador
9%
Schnauzer
9%
Grey Wolf
9%
German Shepard
9%
Dachshund
9%

Current Energy

Vitality +65 points
Lunar Effect -16 points

Traits Breakdown

Body Labrador
Tail Schnauzer
Legs Grey Wolf
Front Legs Golder Retriever
Head German Shepard
Ears Dachshund
Snout French Bulldog
Mouth Pug
Nose Pug
Eyes French Bulldog
Color Golder Retriever