Gia Greta Cryptocurrency Dog - Mix of Shiba Inu, St. Bernard, Labrador, Boxer, Golder Retriever, German Shepard, Rottweiler, Grey Wolf and Maltese

Achievements

Racer
Gia Greta
Forget plastic hotdogs...I'm into the classic chew toys like slippers. Fences are just challenges...I don't let them stop me! I'm not a fan of sleeping on the floor. This body was made for cuddles! I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.
  • Purity 3%
  • Age 13 days
  • Racing Exp 12
  • Shiba Inu 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 2
 Best Time16.07 sec
No rank  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAAACAGATCACACGTACCCACCTGAGTATGA
C
C
A
A
A
C
A
G
A
T
C
A
C
A
C
G
T
A
C
C
C
A
C
C
T
G
A
G
T
A
T
G
A
Genes: 5G87HELKBEB

Composition

Shiba Inu
18%
St. Bernard
18%
Labrador
9%
Boxer
9%
Golder Retriever
9%
German Shepard
9%
Rottweiler
9%
Grey Wolf
9%
Maltese
9%

Current Energy

Vitality +60 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador
Tail Boxer
Legs Golder Retriever
Front Legs German Shepard
Head Rottweiler
Ears Shiba Inu
Snout Grey Wolf
Mouth Maltese
Nose St. Bernard
Eyes Shiba Inu
Color St. Bernard