Ferrari Fyodor Dogstoevsky Virtual Crypto Game Dog - Mix of Grey Wolf, Border Collie, Corgi, Dachshund, Beagle, Shiba Inu, Yorkshire Terrier, German Shepard, French Bulldog and Pug

Achievements

None
Ferrari Fyodor Dogstoevsky
Hey, good-looking! This is Ferrari Fyodor Dogstoevsky. Ima cyber dog. If I can't reach it to clean it myself, it doesn't need cleaning! I'd like to leave my paw prints in the sand next to yours on a moonlit beach. I am on a mission to sniff all the butts in the world. ALL the butts.
  • Purity 1%
  • Age 14 days
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACAGCGGACTAGTACCCTTATCACGACCCGAA
T
A
C
A
G
C
G
G
A
C
T
A
G
T
A
C
C
C
T
T
A
T
C
A
C
G
A
C
C
C
G
A
A
Genes: JOADELF79L2

Composition

Grey Wolf
18%
Border Collie
9%
Corgi
9%
Dachshund
9%
Beagle
9%
Shiba Inu
9%
Yorkshire Terrier
9%
German Shepard
9%
French Bulldog
9%
Pug
9%

Current Energy

Vitality +7 points
Lunar Effect -14 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Dachshund
Front Legs Beagle
Head Shiba Inu
Ears Grey Wolf
Snout Yorkshire Terrier
Mouth German Shepard
Nose French Bulldog
Eyes Grey Wolf
Color Pug