Token Toyota Digital Cryptocurrency Game Dog - Mix of Pitbull terrier, St. Bernard, Maltese, Rottweiler, French Bulldog, Dachshund and Grey Wolf

Achievements

None
Token Toyota
I live in cyberspace where you can turn me on. I enjoy destroying a nice fresh pair of slippers. Fences are just challenges...I don't let them stop me! I'll be honest...Napping is my favorite so we gotta go slow. I hate it when humans put the lid down.
  • Purity 11%
  • Age 14 days
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCACCTGATCCCACCGATGAGGATGACCCTCC
T
C
C
A
C
C
T
G
A
T
C
C
C
A
C
C
G
A
T
G
A
G
G
A
T
G
A
C
C
C
T
C
C
Genes: NKBNH9BABLN

Composition

Pitbull terrier
27%
St. Bernard
27%
Maltese
9%
Rottweiler
9%
French Bulldog
9%
Dachshund
9%
Grey Wolf
9%

Current Energy

Vitality +6 points
Lunar Effect 0 points

Traits Breakdown

Body Pitbull terrier
Tail Maltese
Legs St. Bernard
Front Legs Pitbull terrier
Head Rottweiler
Ears French Bulldog
Snout St. Bernard
Mouth Dachshund
Nose St. Bernard
Eyes Grey Wolf
Color Pitbull terrier

Parents

No Children