Angel Anastasia Litecoin Dog - Mix of Border Collie, Labrador, Husky, Shiba Inu, Poodle, Dachshund, Golder Retriever, Pug and Beagle

Achievements

Racer
Angel Anastasia
Good day to you! I'm Angel Anastasia! I'm willing to try little bondage, so my human chained me up! I hate hiding under the bed during a thunder storm but that's just smart, right? I love car rides when I can stick my head out the window. I enjoy crunchy kibble and drinking from toilets.
  • Purity 5%
  • Age 14 days
  • Racing Exp 28
  • Border Collie 18%
  • 9 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 2 0 1
 Best Time15.53 sec
Rank 60  Racing *** Pts
33.3 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACATACCCACCAGTAGACTACGGAAGAGAACTA
A
C
A
T
A
C
C
C
A
C
C
A
G
T
A
G
A
C
T
A
C
G
G
A
A
G
A
G
A
A
C
T
A
Genes: 4J55EIJA82D

Composition

Border Collie
18%
Labrador
18%
Husky
9%
Shiba Inu
9%
Poodle
9%
Dachshund
9%
Golder Retriever
9%
Pug
9%
Beagle
9%

Current Energy

Vitality +54 points
Lunar Effect -12 points

Traits Breakdown

Body Husky
Tail Border Collie
Legs Labrador
Front Legs Labrador
Head Shiba Inu
Ears Poodle
Snout Border Collie
Mouth Dachshund
Nose Golder Retriever
Eyes Pug
Color Beagle

Parents

No Children

Photos

Litecoin dog racing crypto canine racing Litecoin dog race