Chester Cocoa Cryptocurrency Game Dog - Mix of Border Collie, Labrador, Labrador BK, Rottweiler, Husky, French Bulldog, Pug, Grey Wolf, Shiba Inu and Corgi

Achievements

Racer
Podium Champion
Chester Cocoa
Hi, I'm Chester Cocoa. I'm not a bad dog, my data is just configured that way. I love connecting with my friends via pee-mail. My favorite place in the world is the dog park. So many smells! If you are looking for companionship without commitment, keep looking.
  • Purity 1%
  • Age 14 months
  • Racing Exp 48
  • Border Collie 18%
  • 18 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

18 races   |
  • 1 3 1
 Best Time14.35 sec
No rank  Racing *** Coins
27.8 % wins (5) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: TACCCAGCATACCACACACGAGAACCCGTAAGC
T
A
C
C
C
A
G
C
A
T
A
C
C
A
C
A
C
A
C
G
A
G
A
A
C
C
C
G
T
A
A
G
C
Genes: J56JH492LEO

Composition

Border Collie
18%
Labrador
9%
Labrador BK
9%
Rottweiler
9%
Husky
9%
French Bulldog
9%
Pug
9%
Grey Wolf
9%
Shiba Inu
9%
Corgi
9%

Current Energy

Vitality -8 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Labrador
Legs Labrador BK
Front Legs Border Collie
Head Rottweiler
Ears Husky
Snout French Bulldog
Mouth Pug
Nose Grey Wolf
Eyes Shiba Inu
Color Corgi