Chester Cocoa Cryptocurrency Game Dog - Mix of Border Collie, Labrador, Labrador BK, Rottweiler, Husky, French Bulldog, Pug, Grey Wolf, Shiba Inu and Corgi

Achievements

Racer
TOP 10 Fastest
Chester Cocoa
Hi, I'm Chester Cocoa. I'm not a bad dog, my data is just configured that way. I love connecting with my friends via pee-mail. My favorite place in the world is the dog park. So many smells! If you are looking for companionship without commitment, keep looking.
  • Purity 1%
  • Age 13 days
  • Racing Exp 27
  • Border Collie 18%
  • 8 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 1 2 0
 Best Time14.35 sec
Rank 5  Racing *** Pts
37.5 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACCCAGCATACCACACACGAGAACCCGTAAGC
T
A
C
C
C
A
G
C
A
T
A
C
C
A
C
A
C
A
C
G
A
G
A
A
C
C
C
G
T
A
A
G
C
Genes: J56JH492LEO

Composition

Border Collie
18%
Labrador
9%
Labrador BK
9%
Rottweiler
9%
Husky
9%
French Bulldog
9%
Pug
9%
Grey Wolf
9%
Shiba Inu
9%
Corgi
9%

Current Energy

Vitality +52 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Labrador
Legs Labrador BK
Front Legs Border Collie
Head Rottweiler
Ears Husky
Snout French Bulldog
Mouth Pug
Nose Grey Wolf
Eyes Shiba Inu
Color Corgi

Parents

No Children

Photos

virtual dog race results Bitcoin dog racing crypto dog racing