Crash Bandicoot Codi Digital Cryptocurrency Dog - Mix of Maltese, Shiba Inu, Golder Retriever, Schnauzer, Corgi, Grey Wolf, St. Bernard, Border Collie and Labrador

Achievements

None
Crash Bandicoot Codi
Nice to meet you! I'm Crash Bandicoot Codi. Hound Dog by Elvis is probably the best song ever written. I'm sick of having my nails clipped, those are to help me dig! I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 3%
  • Age 13 days
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 12
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAATAACCGTAAGCGTACCCACCTGATACCCA
A
G
A
A
T
A
A
C
C
G
T
A
A
G
C
G
T
A
C
C
C
A
C
C
T
G
A
T
A
C
C
C
A
Genes: 8CKEOELKBJ5

Composition

Maltese
18%
Shiba Inu
18%
Golder Retriever
9%
Schnauzer
9%
Corgi
9%
Grey Wolf
9%
St. Bernard
9%
Border Collie
9%
Labrador
9%

Current Energy

Vitality +23 points
Lunar Effect +6 points

Traits Breakdown

Body Golder Retriever
Tail Schnauzer
Legs Maltese
Front Legs Shiba Inu
Head Corgi
Ears Shiba Inu
Snout Grey Wolf
Mouth Maltese
Nose St. Bernard
Eyes Border Collie
Color Labrador

Parents

No Children