Amy Aires Cryptocurrency Dog - Mix of St. Bernard and German Shepard

Achievements

None
Amy Aires
I'm going kill that damn Nyan Cat if I can catch it. Rolling around on the carpet after a bath is my favorite way to dry. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) As a perfectionist, I have to find just the right 'spot'.
  • Purity 52%
  • Age 15 days
  • Racing Exp 0
  • St. Bernard 64%
  • 0 races
  • Gen 16
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGATCATCATGATGATCATCATGATGATGATGA
T
G
A
T
C
A
T
C
A
T
G
A
T
G
A
T
C
A
T
C
A
T
G
A
T
G
A
T
G
A
T
G
A
Genes: B77BB77BBBB

Composition

St. Bernard
64%
German Shepard
36%

Current Energy

Vitality +23 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail German Shepard
Legs German Shepard
Front Legs St. Bernard
Head St. Bernard
Ears German Shepard
Snout German Shepard
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard

Parents

No Children