Moxie Mickey Cryptocurrency Game Dog - Mix of St. Bernard, Yorkshire Terrier, Shiba Inu, Golder Retriever, Labrador, Grey Wolf, Labrador BK, Husky and Border Collie

Achievements

None
Moxie Mickey
Once you go digital, baby, you never go back. I've been known to run with bad dogs. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 5%
  • Age 17 days
  • Racing Exp 0
  • St. Bernard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATGAAGACCATTATTACCCGCATGAACATAC
G
T
A
T
G
A
A
G
A
C
C
A
T
T
A
T
T
A
C
C
C
G
C
A
T
G
A
A
C
A
T
A
C
Genes: EB85FFL6B4J

Composition

St. Bernard
18%
Yorkshire Terrier
18%
Shiba Inu
9%
Golder Retriever
9%
Labrador
9%
Grey Wolf
9%
Labrador BK
9%
Husky
9%
Border Collie
9%

Current Energy

Vitality +35 points
Lunar Effect -2 points

Traits Breakdown

Body Shiba Inu
Tail St. Bernard
Legs Golder Retriever
Front Legs Labrador
Head Yorkshire Terrier
Ears Yorkshire Terrier
Snout Grey Wolf
Mouth Labrador BK
Nose St. Bernard
Eyes Husky
Color Border Collie

Parents

No Children