Debo Dickens Litecoin Game Dog - Mix of Corgi, Labrador, Husky, Beagle, Boxer and German Shepard

Achievements

None
Debo Dickens
Hey! My name's Debo Dickens! I love connecting with my friends via pee-mail. Removing excess stuffing from pillows is my favorite hobby. I'm a serial monogamist. I hate bubble baths; mud puddles are more my style. I'm not that picky. Wanna mate?
  • Purity 17%
  • Age 18 days
  • Racing Exp 0
  • Corgi 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCACCAACACTACCAAGCAACAGCTCAAGCAGC
C
C
A
C
C
A
A
C
A
C
T
A
C
C
A
A
G
C
A
A
C
A
G
C
T
C
A
A
G
C
A
G
C
Genes: 554D5OGO7OO

Composition

Corgi
36%
Labrador
27%
Husky
9%
Beagle
9%
Boxer
9%
German Shepard
9%

Current Energy

Vitality +27 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Husky
Front Legs Beagle
Head Labrador
Ears Corgi
Snout Boxer
Mouth Corgi
Nose German Shepard
Eyes Corgi
Color Corgi